دانلود پایان نامه

ن می‌دهد. این نسبت باید بین 8/1 تا 2 باشد. اگر نسبت کوچک‌تر از 8/1 باشد، آلودگی DNA را با پروتئین یا فنل نشان می‌دهد و نسبت بزرگتراز 2 به دلیل وجود RNA در نمونه می باشد.6

از تقسیم جذب نوری (OD) در طول موج 260 نانومتر به جذب نوری در طول موج 280 نانومتر میزان خلوص نمونه ی DNA بدست آمد به این صورت که با از دستگاه NANO DROP که متصل به کامپیوتر می باشد ابتدا مقدار کمی در حد یک حباب آب مقطر ریخته و سپس Blank را زده تا دستگاه آماده اندازه گیری شود و سپس مقدار 1? از ژنوم را در جایگاه مورد نظر ریخته و سپس با زدن کلید Measure عمل محاسبه انجام می گیرد و تصویری همراه با نمودار از ژنوم روی صفحه کامپیوتر حاصل می شود (تصویر شماره3-1).

تصویر شماره 3-1 : کمیت سنجی و غلظت سنجی DNA استخراج شده با استفاده از دستگاه NANO DROP
3-5-5- انجام آزمایشات مولکولی:
3-5-5-1- پرایمر ها:
برای این منظور ابتدا توالی ژن های مورد نظر از پایگاه داده ها NCBI استخراج و سپس یک جفت پرایمر اختصاصی برای هر ژن با استفاده از نرم افزار آنلاین Primer3 با آدرس سایتی (http://frodo.wi.mit.edu/primer3) طراحی گردید. در ادامه میزان اختصاصی بودن پرایمرها با استفاده از Primer-blast با آدرس اینترنتی (http://www.ncbi.gov/tools/primer-blast )مورد ارزیابی قرار گرفت و به منظور آنالیز جهت اطمینان از ساختارهای ثانویه از نرم افزار oligo analyzer استفاده شد. طبق بررسی های به عمل آمده و مرور مطالعات توسط محققین جفت پرایمرهای مناسب انتخاب و جهت تهیه به شرکت پیشگام سفارش داده شد. پرایمرها مهمترین عامل در موفقیت یا عدم موفقیت واکنشPCR هستند و معمولاً براساس توالی شناخته شده DNA الگو طراحی می شوند. اگر پرایمرها به طور صحیح طراحی شده باشند واکنش PCR منجر به تکثیر قطعه ای از DNA می شود که با ناحیه هدف مولکول الگو مطابقت دارد و در صورتی که پرایمرها به طور صحیح طراحی نشوند واکنش با شکست روبه رو می شود. در این حالت هیچ قطعه ای تکثیر نخواهد شد و یا اینکه قطعات اشتباهی تکثیر خواهند شد(جدول 3-1).

جدول 3-1- مشخصات پرایمر های مورد استفاده
ژن هدف
? (3-5 ) سکانس پرایمر
تعداد نوکلئوتید
وزن مولکولی
Cnf
F: TTATATAGTCGTCAAGATGGA

R: CACTAAGCTTTACAATATTGA

21
21
639
Pap
F: GAC GGC TGT ACT GCT GGG TGT GGC G

R: ATA TCC TTT CTG CAG GGA TGC AATA

25
25
328
HlyA
F: AACAAGGATAAGCACTGTTCTGGCT

R: ACCATATAAGCGGTCATTCCCGTCA

25
25
1177
Afa
F: GCTGGGCAGCAAACTGATAACTCTC

R: CATCAAGCTGTTTGTTCGTCCGCCG
25
25
750
Fim
F:GAGAAGAGGTTTGATTTAACTTATTG

R: AGAGCCGCTGTAGAACTGAGG
26
21
559
Aer
F: TACCGGATTGTCATATGCAGACCGT

R: AATATCTTCCTCCAGTCCGGAGAAG
25
25
602
3

3-5-5-2-رقیق سازی پرایمرها:
طبق دستور العمل شرکت سازنده برای رقیق سازی هر کدام از پرایمرها طبق فرمول زیر عمل شد:
N1V1=N2V2 100(PM) × X=10 (PM) × 100(µL) ? 20(µL)
ابتدا پرایمرهای موجود برای ژن های اختصاصی برای همه ژن های ویرولانس (که به صورت لیوفیلیزه بودند) طبق دستورالعمل ارسال شده از طرف شرکت پیشگام تا غلظت PMOL/ µL100 با آب مقطر دوبار استریل رقیق شده و به عنوان استوک برای نگهداری طولانی مدت در فریزر20- درجه منتقل شد و محلول کاری با اضافه کردن µL 90 آب مقطر به µL 10 محلول استوک فراهم شد.
3-5-6- PCR
3-5-6-1-بهینه سازی اجزاء واکنش PCR
واکنش PCR در شرایط توصیه شده توسط سایر محققین در دستگاه مستر سایکلر اپندورف گرادیانت طبق جدول زیر انجام گردید، اجزا و ترکیبات مورد استفاده برای واکنش PCR برای تمامی 6 ژن یکسان می باشد (جدول شماره 3-2)

جدول 3-2: اجزاء و ترکیبات مورد استفاده برای واکنش PCR
اجزای واکنش
غلظت
حجم(میکرولیتر)
مستر میکسAmpliqon واجد Taq DNA polymerase به همراه بافر) dNTP (2X وکلرید منیزیم
X2
10
پرایمر فوروارد
10 پیکومول/ میکرولیتر
1
پرایمر ریورس
10 پیکومول/ میکرولیتر
1
ژنوم

1
آب مقطر آمپولی استریل

7
حجم نهایی

20

3-5-6-2-بهینه سازی تهیه Master Mix
در ابتدا بدون تهیه رقت از پرایمرها مستر میکس تهیه شد و به طور تصادفی از ژنوم استخراج شده شماره 23، PCR انجام شد که پس از مراحل الکتروفورز و رنگ آمیزی تجمع پرایمر محسوس بود. سپس با تهیه رقت از پرایمر طی چند مرحله، در نهایت رقت 20(pm) و حجم 2(µl) بدست آمد، که با انجام PCR جواب های قابل قبولی حاصل شد.

3-5-7- گرادیانت دمایی جهت بدست آوردن دمای اتصال برای ژن aer
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 23 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از 69-68-67-66 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 68 درجه در ژن aer استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود. برنامه دمایی مورد استفاده برای یک واکنش PCR برای ژن aer در( جدول شماره 3-3) آمده است.

جدول 3-3: برنامه دمایی ترموسایکلر برای ژن aer
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°68
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

3-5-7-1-گرادیانت دمایی جهت بدست آوردن دمای اتصال برای ژن HlyA
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 5 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از 67-66-65-64-63-62-61-60-59-58 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 62 درجه در ژن HlyA استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود. برنامه دمایی مورد استفاده برای یک واکنش PCR برای ژن HlyA در( جدول شماره 3-4) آمده است.

جدول 3-4: برنامه دمایی ترموسایکلر برای ژن HlyA
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°62
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

3-5-7-2- گرادیانت دمایی جهت بدست آوردن دمای اتصال برای Pap
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 2 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از72-71-70-69-68-67-66-65-64-63-62-61 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 63 درجه در ژن Pap استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود. برنامه دمایی مورد استفاده برای یک واکنش PCR برای ژن Pap در( جدول شماره 3-5)آمده است.

این مطلب رو هم توصیه می کنم بخونین:   چرخه عمر، نقشه راه

جدول 3-5 : برنامه دمایی ترموسایکلر برای ژن Pap
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°63
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

3-5-7-3- گرادیانت دمایی جهت بدست آوردن دمای اتصال برای Cnf
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 5 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از59-58-57-56-55-54-53-52-51 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 57 درجه در ژن CNF استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود. برنامه دمایی مورد استفاده برای یک واکنش PCR برای ژن CNF در( جدول شماره 3-6)آمده است.

جدول 3-6: برنامه دمایی ترموسایکلر برای ژن CNF

مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30

1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°57
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

3
3-5-7-4- گرادیانت دمایی جهت بدست آوردن دمای اتصال برای Afa
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 1 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از67-66-65-64-63-62-61-60-59-58-57 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 65 درجه در ژن Afa استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود. برنامه دمایی مورد استفاده برای یک واکنشPCR برای ژن Afa در( جدول شماره 3-7)آمده است.

جدول 3-7: برنامه دمایی ترموسایکلر برای ژن ژن Afa
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°65
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

3
3-5-7-5- گرادیانت دمایی جهت بدست آوردن دمای اتصال برای Fim
در ابتدا قبل از شروع PCR برای بدست آوردن دمای اتصال گرادیانت دمایی انجام گردید، نمونه مورد نظر برای این کار نمونه شماره 11 انتخاب گردید، دماهای انتخاب شده برای انجام گرادیانت دمایی به ترتیب عبارتند از64 -63-62-61-60-59 با هر دو پرایمر فوروارد و ریورس، سپس الکتروفورز انجام گردید و بعد از مشاهده باندها تصمیم گرفته شد که از دمای 59 درجه در ژن Fim استفاده شود چون وضوح باند در هر دو پرایمر فوروارد و ریورس در این دما بیشتر بود برنامه دمایی مورد استفاده برای یک واکنش PCR برای ژن Fim در( جدول شماره 3-8)آمده است.

جدول 3-8: برنامه دمایی ترموسایکلر برای ژن Fim
مراحل PCR
دما برحسب درجه
زمان
تعداد چرخه
نام چرخه
واسرشت اولیه
C°95
5 دقیقه
1

30
1
اول

دوم
سوم
واسرشت شدن
C°94
1 دقیقه

اتصال
C°59
1 دقیقه

گسترش
C°72
1 دقیقه

گسترش نهایی
C°72
7 دقیقه

. 3-6-مراحل انجام PCR
مرحله واسرشتی او
لیه1: در این مرحله ابتدا با استفاده از حرارت دو رشته DNA از هم باز می شوند. مطابق با جدول دمای دناتوراسیون C°95 و زمان مورد نیاز معمولاً 5دقیقه است.
از این مرحله به بعد وارد برنامه چرخه ای PCR می شویم که خود شامل سه مرحله است:
مرحله واسرشتی2: این مرحله نیز مانند مرحله واسرشتی اولیه، اما با زمانی کوتاهتر از آن انجام می گیرد. دو رشته DNA بطور کامل در این مرحله از هم جدا می شوند. دمای مورد استفاده در این مرحله 95درجه سلسیوس به مدت 30 ثانیه است.
مرحله اتصال3 :در این مرحله با پایین آوردن دما و رساندن آن به حد مناسب تلاش می شود تا پرایمرها بتوانند با رشته مکمل خود در DNA الگو جفت شوند.
مرحله طویل شدن4: دما باید برای فعالیت آنزیم پلیمراز مناسب باشد و در این مرحله رشته مکمل رشته الگو ساخته خواهد شد و از آنجا که رشته های ساخته شده جدید نیز مکمل آغازگرها هستند، این چرخه حرارتی می تواند چندین بار تکرار شود و به همین طریق ساخت و تکثیر قطعات ادامه می یابد. دمای این مرحله 72 درجه سلسیوس می باشد که برای فعالیت آنزیم پلیمراز مناسب است.7

3-6-1-بهینه‌سازی PCR
بهینه‌سازی یعنی تعیین غلظت‌های مناسب مواد واکنشگر و دمای مناسب اتصال پرایمرها (Tm) جهت به دست آوردن محصول PCR مناسب برای این منظور برای هر یک از پارامترها مثلTm آزمایشات مختلف انجام شد سپس با بررسی محصول و نوع پرایمرها و نیز شرایط واکنش، بهترین دما و سیکل انتخاب گردید.
به منظور بدست آوردن دمای مناسب برای هر یک از پرایمرها جهت انجام واکنش PCR، نمونه کنترل مثبت را با یک جفت پرایمر گرادیانت دمایی گذاشتیم و دمای مناسب هر یک گزارش شد.
عمل بهینه نمودن واکنش با تغییرات جزء به جزء و مرحله به مرحله در غلظت‌های DNA الگو، پرایمر، dNTPs، MgCI2، polymerase DNA Taq و بهترین دمای Annealing صورت گرفت تا اینکه شرایط بهینه جهت تکثیر ژن‌های ویرولانس حاصل آمد.
3-6-2- بررسی محصول PCR
جهت آشکارسازی محصول PCR از روش متداول و سریع الکتروفورز ژل آگاروز و رنگ‌آمیزی با اتیدیوم بروماید برای آشکارسازی سکانس هدف تکثیر یافته استفاده می‌کنیم.
آگارز پلی ساکاریدی است که در اثر حرارت در بافر مناسب خود به صورت‌ ژله‌ای با آرایش پلیمری منظم و قطر منافذ مشخص در می‌آید. این منافذ امکان عبور ماکرومولکول‌های DNA را در ژل آگاروز حین انجام الکتروفورز از قطب منفی (کاتد) به سمت قطب مثبت (آند) فراهم می‌کند. غلظت بالاتر ژل آگاروز سبب ایجاد منافذ ریزتر می‌شود که قدرت تفکیک اندازه ‌DNA کوچکتری را فراهم می‌کند.
با دانستن طول سکانس هدف، غلظت ژل آگاروز را برای بررسی محصول PCR خود تعیین کرده و ژل مناسب را تهیه نمودیم.
حدود 6 میکرولیتر از نمونه‌ها با 5/1 میکرولیتر از بافر لود کننده با غلظت 6 شرکت سیناژن، به خوبی مخلوط گردیده و در چاهک‌های ژل قرار داده می‌شدند.
جهت بهینه نمودن الکتروفورز، این عمل در حالات و شرایط مختلف آزمایش گردید. بدین منظور انواع آگاروز از شرکت‌های خارجی از جمله Gibco BRL, Bio Rad, Digma, Roche هم چنین انواع بافرها با غلظت‌ها و نسبت‌های مختلف مواد تشکیل دهنده


دیدگاهتان را بنویسید